Here's some things I need help with.
But first of all, please let me pull up the code first.
from base_printer import *
def dna_complement(dna):
coup = ""
for letter in dna:
if letter == "C":
coup = "G"
if letter == "G":
coup = "C"
if letter == "A":
coup = "T"
if letter == "T":
coup = "A"
return coup
def convert_to_rna(dna):
coup2 = ""
for letter in dna:
if letter == "C":
coup2 = "G"
if letter == "G":
coup2 = "C"
if letter == "A":
coup2 = "U"
if letter == "T":
coup2 = "A"
return coup2
def translate(rna):
amino_acid = ""
for i in range(len(rna)-2):
three_letter = rna[i:i 3]
if three_letter in CODON_TABLE:
amino_acid = CODON_TABLE[three_letter]
i = 2
return amino_acid
CODON_TABLE = {'UUU':'Phe','UUC':'Phe','UUA':'Leu','UUG':'Leu','CUU':'Leu','CUC':'Leu','CUA':'Leu','CUG':'Leu','AUU':'Ile','AUC':'Ile','AUA':'Ile','AUG':'Met','GUU':'Val','GUC':'Val','GUA':'Val','GUG':'Val','UCU':'Ser','UCC':'Ser','UCA':'Ser','UCG':'Ser','CCU':'Pro','CCC':'Pro','CCA':'Pro','CCG':'Pro','ACU':'Thr','ACC':'Thr','ACA':'Thr','ACG':'Thr','GCU':'Ala','GCC':'Ala','GCA':'Ala','GCG':'Ala','UAU':'Tyr','UAC':'Tyr','UAA':'STOP','UAG':'STOP','CAU':'His','CAC':'His','CAA':'Gln','CAG':'Gln','AAU':'Asn','AAC':'Asn','AAA':'Lys','AAG':'Lys','GAU':'Asp','GAC':'Asp','GAA':'Glu','GAG':'Glu','UGU':'Cys','UGC':'Cys','UGA':'STOP','UGG':'Trp','CGU':'Arg','CGC':'Arg','CGA':'Arg','CGG':'Arg','AGU':'Ser','AGC':'Ser','AGA':'Arg','AGG':'Arg','GGU':'Gly','GGC':'Gly','GGA':'Gly','GGG':'Gly'}
dna="AAGAGATGCCATTGTCCCCCGGCCTCCTGCTGCTGCTCTTAGCGGGGCCACATCGGCCACCGCTGCCCTGCCCCTGGAGGGTGGCCCCACCGGCCGTTACAGCGAGCATAC"
def main():
print("\nWelcome to the DNA program: The Code of Life.")
print("\nSample DNA strand:\n")
print("Regular DNA:")
print_bases(dna)
print("DNA after complement: ")
dna2 = dna_complement(dna)
print_bases(dna2)
print("DNA after RNA convertion: ")
rna = convert_to_rna(dna)
print_bases(rna)
print("The result of translation: ")
amino_acid = translate(rna)
print_bases(amino_acid)
main()
I was trying to get the Codon printing out as everyone can see, the output of translation have been successfully printed out as
PHESERLEUSERLEUTYRTHRARGGLYVALSTOPASNTHRGLNARGGLYGLYGLYGLYALAPROARGGLYGLUARGGLYASPTHRARGASPTHRARGASPTHRARGGLUARGGLUASNILESERARGALAPROPROPROARGGLYVALCYSVALSTOPSERALAPROARGGLYVALTRPGLYALAARGASPTHRARGGLYGLYASPTHRARGGLYGLYGLYASPTHRPROLEUSERPROPROHISTHRPROARGGLYGLYGLYVALTRPGLYALAPROARGGLYALAGLNASNMETCYSVALSERARGALALEUSERARGVALTYRMET
Now what I want to do is to have spaces separating each of the Codons listed in the program outputs and stop the generation once it reached UAA/UGA/UAG which is what I'm trying to figure out. But now the problem is I don't know where I should even start with which is embarrassing.
An example of output I want: Phe Ser Leu Ser Leu Tyr (Stops once reaching the UAA/UGA/UAG)
Would someone be willing to offer some tips?
Edit: Here's the information of base_print , it basically prints the output out in different colors
import colorama as cr
cr.init(autoreset=True)
def print_bases(string):
"""prints dna/rna bases with color coding for each base"""
for char in string.upper():
if char == "A":
print(cr.Back.BLACK cr.Fore.GREEN cr.Style.BRIGHT char, end="")
elif char == "C":
print(cr.Back.BLACK cr.Fore.YELLOW cr.Style.BRIGHT char, end="")
elif char == "T":
print(cr.Back.BLACK cr.Fore.BLUE cr.Style.BRIGHT char, end="")
elif char == "G":
print(cr.Back.BLACK cr.Fore.MAGENTA cr.Style.BRIGHT char, end="")
elif char == "U":
print(cr.Back.BLACK cr.Fore.WHITE char, end="")
else:
print(char, end="")
print()
CodePudding user response:
Here is how I would do it
def translate(rna):
amino_acid = []
for i in range(len(rna) - 2):
three_letter = rna[i:i 3]
if three_letter in ['UAA', 'UGA', 'UAG']:
break
if three_letter in CODON_TABLE:
amino_acid.append(CODON_TABLE[three_letter])
i = 2
return ' '.join(amino_acid)
CodePudding user response:
Assuming you're trying to print everything prior to 'STOP' sliced into 3 characters each, here's an extension of your main function:
res = amino_acid[:amino_acid.index('STOP')] if 'STOP' in amino_acid else amino_acid
res = ' '.join(res[i:i 3] for i in range(0, len(res), 3))
print(res)
Alternatively, if you only want to translate until you reach a stop codon and already have you amino acid with spaces, here's a modification of your translate function:
def translate(rna):
amino_acid = ""
for i in range(len(rna) - 2):
three_letter = rna[i:i 3]
if three_letter in CODON_TABLE:
next_aa = CODON_TABLE[three_letter]
if next_aa == 'STOP':
return amino_acid.strip()
amino_acid = ' ' next_aa
i = 2
return amino_acid.strip()
Output:
Phe Ser Leu Ser Leu Tyr Thr Arg Gly Val
