I've been working on java programming developed to find the gene in DNA strands. My question is why the for loop ends up at dna[2] and the output stucked at the third String and no more results are returned. The following is the code:
import edu.duke.*;
import java.io.*;
public class Part1 {
public String findSimpleGene (String dna) {
String result = "";
int startIndex = dna.indexOf("atg");
int stopIndex = dna.indexOf("taa", startIndex 3);
result = dna.substring(startIndex, stopIndex 3);
if (startIndex != -1
&& stopIndex != -1
&& (stopIndex - startIndex) % 3 ==0) {
return result;
}
else {
return "Not Exist";
}
}
public void testSimpleGene () {
String dna[] = new String[5];
dna[0] = "cccatggggtaaaaatgataataggagagagagagagagttt";
dna[1] = "ccatggggtctaaataataa";
dna[2] = "atggggcgtaaagaataa";
dna[3] = "acggggtttgaagaatgaaccaat";
dna[4] = "acggggtttgaagaatgaaccaataacga";
for (int i=0; i < 5; i ) {
String result = findSimpleGene(dna[i]);
System.out.println("DNA strand:" dna[i]);
System.out.println("Gene:" result);
}
}
}
Thanks!
CodePudding user response:
For dna[3] = "acggggtttgaagaatgaaccaat"
startIndex is 14 and stopIndex is -1 since there is no "taa"
After that you are finding subString(14,2) which will throw below exception in this case.
Method threw 'java.lang.StringIndexOutOfBoundsException' exception
CodePudding user response:
For
dna[3] = "acggggtttgaagaatgaaccaat";
Your code is throwing StringIndexOutOfBoundsException exception & hence you sees it is no longer advancing to next iteration of for loop :
int startIndex = dna.indexOf("atg"); // gives 14
int stopIndex = dna.indexOf("taa", startIndex 3); // gives -1
result = dna.substring(startIndex, stopIndex 3); //throws `StringIndexOutOfBoundsException` because startIndex is larger than stopIndex.
To avoid this kind of scenario, you can check startIndex is always less than stopIndex before calling substring:
if(startIndex < stopIndex && startIndex!=-1 && stopIndex < dna.length()){
result = dna.substring(startIndex, stopIndex 3);
..}
